Define/Explain: $A$ promoter and the structural gene.
(N/A) promoter is a $DNA$ sequence that provides a binding site for $RNA$ polymerase. It is located at the $5'$ end of the structural gene.
- The structural gene in a transcription unit is the segment of $DNA$ that codes for a polypeptide or $RNA$ molecule and is flanked by a promoter and a terminator.
- The structural gene in a transcription unit is the segment of $DNA$ that codes for a polypeptide or $RNA$ molecule and is flanked by a promoter and a terminator.
Explore More
Similar Questions
$A$ mature eukaryotic $m-RNA$ is identified by:
Medium
View SolutionWhat is correct for bacterial transcription?
Medium
View SolutionWhich one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?
MediumNEET 2023
View SolutionHow many adenylate residues are added in the process of tailing?
Medium
View SolutionMatch the following $RNA$ polymerase enzymes with their transcribed products:
$(a) \; RNA$ polymerase $I$ $(i) \; tRNA$ $(b) \; RNA$ polymerase $II$ $(ii) \; rRNA$ $(c) \; RNA$ polymerase $III$ $(iii) \; hnRNA$
Select the correct option from the following:
| $(a) \; RNA$ polymerase $I$ | $(i) \; tRNA$ |
| $(b) \; RNA$ polymerase $II$ | $(ii) \; rRNA$ |
| $(c) \; RNA$ polymerase $III$ | $(iii) \; hnRNA$ |
Select the correct option from the following:
DifficultNEET 2019
View SolutionVedclass Products
For Students
Vedclass Test Series
Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.
Start Free TrialFor Teachers
Exam Paper Generator
Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.
Try FreeFor Institutes
Online Exam Module
Live online exams with unlimited students, 360° analytics & white-label branding.
See Demo